GC content calculator

GC content is the percentage of a DNA sequence's bases that are guanine or cytosine: %GC = (G + C) / length × 100. It predicts duplex stability — GC pairs stack more strongly than AT pairs — and drives primer design targets of roughly 40–60% GC.

Result

GC content42.42%
Length33nt
A12
C5
G9
T7

GC% = (G + C) / length × 100. Ambiguous IUPAC bases count toward length but not toward G+C.

Doing this for a real construct?

Talindrew runs it on your actual sequence — editor, cloning wizards and analysis in the browser, free.

Sign up free

Formula

%GC = (G + C) / N × 100

Source: Definition; base counting per the IUPAC alphabet

Worked example

Given: 33 nt sequence ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA

  1. 1.Count bases: A 12, C 5, G 9, T 7 — G + C = 14.
  2. 2.%GC = 14 / 33 × 100 = 42.4%.

GC content = 42.4%

How the calculation flows

GC content calculator — calculation flowWhitespace and numbering are stripped, bases are counted, and GC percentage is reported with the full composition.sequencepaste, any formatcount G + Cvs total length%GCand composition
Whitespace and numbering are stripped, bases are counted, and GC percentage is reported with the full composition.

Units & constants

Primer design target40–60% GC; GC-clamp of 1–2 G/C at the 3′ end
E. coli genome~50.8% GC
S. cerevisiae genome~38% GC
Human genome~41% GC average, 30–60% by isochore
Ambiguity codesCount toward length, not toward G+C
PriceFree

Why does GC content matter for primers?

GC pairs form three hydrogen bonds and stack more favourably than AT pairs, so GC content is the coarsest predictor of how tightly an oligo binds. Primers below ~40% GC melt too readily and need longer sequences to compensate; above ~60%, secondary structure and mispriming risk climb. A G or C at the 3′ end (a 'GC clamp') stabilises the exact position where the polymerase extends.

What does GC content do to PCR and sequencing?

GC-rich templates (> 65%) form stable secondary structures that stall polymerases — the standard remedies are DMSO or betaine additives, higher denaturation temperatures, and specialised polymerase formulations. AT-rich stretches cause polymerase slippage in homopolymer runs. Knowing the number tells you which failure mode to guard against before the first run.

Frequently asked questions

What is a good GC content for PCR primers?
40–60%, with the pair matched and a G or C at the 3′ end if possible. Outside that window, compensate with primer length (low GC) or additives and careful design (high GC).
How are IUPAC ambiguity codes counted?
They count toward sequence length but not toward G+C, so a sequence with many N's reports a lower bound on GC content. For exact numbers, resolve the ambiguities first.

Related calculators & guides

Use this calculator inside the app.

Free to use. No download required. Sign in and you land right back on this calculator.

Start for free