Oligo melting temperature (4 methods)

An oligo's melting temperature is the temperature at which half the duplex is dissociated. The most accurate general method is nearest-neighbor thermodynamics (SantaLucia 1998), which sums stacking energies of adjacent base pairs and corrects for salt and oligo concentration. Quick formulas — Wallace 2(A+T)+4(G+C) for short oligos, the GC formula for longer ones — bracket the same answer within a few degrees.

mM
nM

Result

Nearest-neighbor Tm (SantaLucia 1998)56.7°C
Salt-adjusted Tm48.9°C
GC-content Tm (≥ 14 nt)54°C
Wallace rule (< 14 nt)68°C
Length24nt
GC content41.7%

Four published methods side by side — they disagree by design (different models and assumed conditions). For PCR primers, trust the nearest-neighbor value; unambiguous A/C/G/T sequences of ≥ 8 nt only.

Doing this for a real construct?

Talindrew runs it on your actual sequence — editor, cloning wizards and analysis in the browser, free.

Sign up free

Formula

Tm = ΔH × 1000 / (ΔS + 0.368·(N−1)·ln[Na⁺] + R·ln(Cₜ/4)) − 273.15

Source: SantaLucia, PNAS 1998 (unified NN parameters); von Ahsen 2001 salt correction

Wallace: Tm = 2·(A+T) + 4·(G+C) (< 14 nt)

Source: Wallace et al., NAR 1979

GC formula: Tm = 64.9 + 41·(G+C − 16.4)/N · salt-adjusted: 81.5 + 16.6·log₁₀[Na⁺] + 0.41·%GC − 675/N

Source: Marmur–Doty / Schildkraut–Lifson forms as implemented in OligoCalc (Kibbe, NAR 2007)

Worked example

Given: 24-mer AGCGGATAACAATTTCACACAGGA at 50 mM Na⁺, 250 nM total oligo

  1. 1.Sum SantaLucia ΔH and ΔS over the 23 dinucleotide steps, plus initiation terms for the terminal A·T pairs.
  2. 2.Correct the entropy for salt: ΔS + 0.368 × 23 × ln(0.05).
  3. 3.Tm = ΔH·1000 / (ΔS + R·ln(Cₜ/4)) − 273.15 = 56.7 °C.
  4. 4.Quick checks: Wallace gives 68 °C (over-estimates beyond 14 nt); the GC formula gives 54.0 °C.

Nearest-neighbor Tm = 56.7 °C

How the calculation flows

Oligo melting temperature (4 methods) — calculation flowNearest-neighbor Tm: stacking enthalpies and entropies of each dinucleotide step are summed, then corrected for salt and oligo concentration.sequence5′ → 3′Σ ΔH, ΔSNN stacking termssalt + conc.correctionsTm°C
Nearest-neighbor Tm: stacking enthalpies and entropies of each dinucleotide step are summed, then corrected for salt and oligo concentration.

Units & constants

NN parameter setSantaLucia 1998 unified (same as BioPython Tm_NN default)
Salt correctionΔS + 0.368·(N−1)·ln[Na⁺] (von Ahsen 2001)
Default conditions50 mM Na⁺, 250 nM total oligo (IDT's defaults)
Self-complementary oligosDetected automatically; symmetry correction and Cₜ/1 applied
Verified againstBioPython Tm_NN to < 0.01 °C on fixture primers
ApplicabilityUnambiguous A/C/G/T oligos, ~8–60 nt
PriceFree

Why do Tm calculators disagree with each other?

Because they answer subtly different questions. The Wallace rule counts bases and assumes ~0.9 M salt; the GC formula ignores base order entirely; nearest-neighbor models account for the fact that a GC pair stacked on another GC pair is more stable than the same pair next to an AT. On top of the model, every tool assumes its own salt and oligo concentrations — NEB's calculator even folds in polymerase-buffer-specific corrections. Two tools reporting 5 °C apart can both be internally correct. This page shows all four methods at once so the spread is visible instead of surprising.

Which Tm method should you use for PCR primers?

Nearest-neighbor, with conditions close to your reaction. For routine cloning primers (18–25 nt, 40–60% GC) set the annealing temperature a few degrees below the NN Tm of the lower primer, or use the annealing-temperature calculator linked below. Reserve the Wallace rule for very short probes and quick mental arithmetic; use vendor calculators (NEB, IDT) when their buffer-specific models match the polymerase you are running.

What conditions does this calculator assume?

Defaults are 50 mM monovalent salt and 250 nM total oligo — the same defaults as IDT OligoAnalyzer, which makes side-by-side comparison easy. Both are editable. Mg²⁺ and dNTP corrections (Owczarzy 2008) are not yet applied; PCR buffers with ~1.5–3 mM free Mg²⁺ raise the effective Tm by roughly 2–6 °C relative to the Na⁺-only value.

Frequently asked questions

Why is my Wallace-rule Tm so much higher than the nearest-neighbor value?
The Wallace rule was calibrated for oligos under 14 nt hybridising on filters at high salt (~0.9 M Na⁺). Applied to a 20-mer at PCR-like salt it typically over-estimates by 5–10 °C. It is shown here for short oligos and for comparison, not as the number to design around.
Does this match IDT OligoAnalyzer or the NEB Tm calculator?
At matching conditions (50 mM Na⁺, 250 nM oligo) the nearest-neighbor value here tracks IDT's within a few tenths of a degree — both use SantaLucia parameters. NEB's calculator applies buffer-specific corrections for its polymerases, so its numbers can sit a few degrees away; that is expected, not an error.
Should the primer tail be included when calculating Tm?
No. For cloning primers with 5′ tails (restriction sites, Gibson overlaps), calculate Tm on the template-binding region only — the tail does not anneal in early cycles, and including it overestimates the annealing temperature.

Related calculators & guides

Use this calculator inside the app.

Free to use. No download required. Sign in and you land right back on this calculator.

Start for free