Everything a bench scientist opens in a day
Talindrew covers the ground SnapGene covers: cloning simulation, primer design, enzymes, gels, annotation, multiple sequence alignment, plasmid maps, adds a cloning workspace that reads and writes OpenCloning strategies, and then keeps going into structure prediction and drug discovery. In a browser tab.
Everything listed below is built and running today. Where a capability doesn't exist yet, it isn't on this page.
01 / Cloning
Every mainstream cloning strategy, simulated end to end.
Eight strategies run against a real digest-and-ligate engine, not a diagram generator. Six of them have a guided wizard with a worked example; the rest run from the node-graph designer. Each design is checked before you commit to it. The cloning workspace below is a second, separate surface for the same work, and the wizards are unchanged by it.
- Restriction cloning: enzyme pair, compatible ends, ligated product
- Gibson Assembly: multi-fragment homology with overlap Tm tuning
- Golden Gate: Type IIS, 4-nt fusion sites, scarless assembly
- Gateway: BP and LR recombination at att sites
- TOPO and TA: topoisomerase kits, A-overhang checking
- In-Fusion and NEBuilder HiFi assembly
- Site-directed mutagenesis: QuikChange and NEB Q5 SDM primers
- Pre-flight design check: overhang compatibility, single-cut verification, methylation blocking
- Standalone digest → ligate → transform simulation
- Node-graph designer for multi-step protocols
EGFP head into the pUC19 MCS, cut EcoRI / BamHI and ligated directionally.
pUC19 MCS
2,686 bp · circular
EGFP head
180 bp · linear
One of six worked examples; all six run in the app.
02 / Cloning workspace
A full port of OpenCloning, running the same engine.
The workspace is OpenCloning (app.opencloning.org) rebuilt inside Talindrew: the same node graph, the same sixteen operations, and OpenCloning's cloning-strategy JSON as the saved format, so a strategy moves between the two tools in either direction. The reactions themselves run through OpenCloning's own pydna engine, hosted in Talindrew's backend.
- OpenCloning's cloning-strategy JSON is the saved format: load it, save it, and open the same file in either tool
- Reactions run through the pydna engine in Talindrew's own backend, under /api/v1/oc
- Sixteen operation types on one node graph, beside every way of getting a sequence in, each step showing the sequence it produced
- Import by hand, or from GenBank, FASTA, EMBL and SnapGene files, including a SnapGene file's embedded cloning history
- Repository import: Addgene, iGEM, SEVA, Euroscarf, WeKwikGene, Benchling, SnapGene and Open DNA Collections
- Genome regions from NCBI by assembly, gene or explicit coordinates
- Operations: restriction digest, PCR, oligonucleotide hybridisation, polymerase extension, reverse complement and annotation
- Assemblies: Gibson, In-Fusion, In vivo and overlap-extension; restriction and ligation (Golden Gate); ligation; homologous recombination; CRISPR-HDR; Gateway BP and LR; Cre/Lox and recombinases with custom sites
- Annotation against Talindrew's own feature library, or pLannotate where the deployment is configured with it
- Every sequence node draws a real circular or linear map, with a shape toggle
- Eleven bundled example strategies; the draft survives a refresh and autosaves to the server once saved
- Kit templates from the OpenCloning submission repository, MoClo YTK included, with category slots and placeholder parts
- Golden Gate assembler: load a syntax, chain the categories, classify your own part plasmids, assemble every valid combination, download the results as a zip
- Syntax builder: parts, overhangs, graph validation and a mermaid diagram, saved as JSON
- Primers tab with primer3 thermodynamics: Tm, GC, homodimer, hairpin, and a heterodimer figure per PCR, with csv/tsv import and export
- Primer designer for normal PCR, restriction and ligation with enzyme tails, Gibson-family assembly, homologous recombination and CRISPR, Gateway BP with the known pDONR combinations, and EBIC: it previews the product and writes the primers back onto the PCR steps
- Sequencing verification: attach AB1, SCF or ZTR traces, aligned server-side, with coverage drawn on both maps, identity, a mismatch table and the chromatogram; the strategy zip carries the traces
- Save any reaction into a notebook entry as a cloning block that links back to the workspace
- Share a workspace by link, read-only for anyone with the URL, or with named people as viewer or editor, with a notification
See it in 1:07
MoClo YTK template, eight parts, BsaI, a 5,459 bp product.
16 operations, one node graph
03 / Primers & PCR
Design the primers, then the reaction.
Select a region and get ranked primer pairs, re-ranked live as you move the constraints. Cloning primers still come out of the strategy itself. Every Tm is the same nearest-neighbour number the melting temperature calculator reports, so the two can never disagree.
- Primer design over any selected region: ranked candidate pairs, re-ranked as the sliders move
- Per-primer scoring: Tm, GC content, length, 3′ GC clamp, homopolymer runs, hairpins, self- and 3′-anchored dimers, binding-site count
- Pair scoring on ΔTm, cross-dimers and product size. Defaults are 18–30 nt, Tm 55–68 °C, GC 40–60 %, ΔTm ≤ 3 °C
- Binding-site search on both strands with amplicon prediction, including products that cross the origin of a circular template
- 5′ overhang builder: 13 restriction sites with guard bases, Kozak, T7 promoter, His₆ tag, Gibson/HiFi homology arms or custom text. Annealing Tm and full-oligo Tm are reported separately
- Per-sequence primer library: import from FASTA or a pasted list, export CSV or FASTA, analyse at IDT, drawn on both maps, exported as primer_bind features
- Automatic cloning primer design with strategy-specific tails
- Mutagenic primer design for substitutions, insertions and deletions
- PCR simulation with product prediction
- Oligo annealing calculator: duplex Tm plus compatible-overhang enzyme lookup
- Built-in M13, T7, T3 and SP6 priming sites detected on any construct
- Create a primer from a selection in the viewer: it lands in the Oligos library, and in the workspace's primers when the sequence came from there
Design primers
| # | Forward | Reverse | Tm F / R | ΔTm | Product | Score |
|---|---|---|---|---|---|---|
| 1 | CCCCCTGACG… | TTCCGGCTGG… | 60.2 / 60.1 | 0.1 | 937 bp | 5.2 |
| 2 | CCCCCTGACG… | CCTTCCGGCT… | 60.2 / 60.2 | 0.0 | 939 bp | 5.4 |
| 3 | CCCCCTGACG… | TCCGGCTGGC… | 60.2 / 59.8 | 0.3 | 936 bp | 6.0 |
| 4 | TTTTCCATAG… | CCGGCTGGCT… | 58.6 / 58.7 | 0.1 | 952 bp | 6.0 |
| 5 | CCCCTGACGA… | TGCTGATAAA… | 60.5 / 60.5 | 0.0 | 917 bp | 6.1 |
5'–CCCCCTGACGAGCATCACAAAAATC–3'
5'–TTCCGGCTGGCTGGTTTATTGC–3'
Predicted product
⚠ Run of 5 identical bases.
04 / Restriction enzymes
Pick a set, scan, and see what your host will actually cut.
The digest runs over REBASE through eleven predefined enzyme sets, and it accounts for host methylation: the reason a clean-looking digest fails at the bench.
- Eleven enzyme sets: all commercial, non-redundant, NEB, Thermo/Fermentas
- Cutter-type sets: unique cutters, unique dual cutters, 6+ cutters, Type IIS, Golden Gate, nicking
- Dam, Dcm and EcoKI methylation sensitivity applied to the scan
- Per-enzyme detail: recognition site, cut positions, overhang, isoschizomers, compatible ends
- Vendor availability, NEB buffer activity table and incubation temperature
- Silent mutagenesis to add or remove a site without changing the protein
- Cut sites overlaid on the circular and linear maps
Enzyme set
Host methylation
05 / Gel simulation
Run the gel before you pour it.
Migration is modelled from fragment size against gel percentage, voltage and run time, so you can tell in advance whether two bands will actually resolve.
- Configurable gel percentage, voltage, run time and buffer
- Six MW ladders: NEB 1 kb and 100 bp, GeneRuler 1 kb and 100 bp, TrackIt 1 kb Plus, AmpliSize
- Arbitrary multi-lane layouts with per-lane fragment lists
- Digest fragment sizes fed straight in from a restriction scan
- Import and view SnapGene .gel documents
NEB 100 bp
Gibson fragments
Golden Gate parts
06 / Features & annotations
Paste a sequence, get it annotated.
A 60-feature reference library is matched against your sequence on both strands, with fuzzy matching and circular wrap-around, so a raw paste comes back labelled.
- Automatic detection against 60 common features
- Resistance markers, origins, promoters, tags and priming sites
- Exact and mismatch-tolerant matching, both strands, circular-aware
- Colour-coded feature table with search and type filtering
- Bulk select, copy and delete across features
- Import annotations from BED, GFF3 and GTF tracks
- Detect common features on demand from the Features tab
- Priming sites matched on both strands and listed beside the features
- Create, edit, duplicate and delete a feature from the viewer's right-click menu: name, type, strand, bounds and note, all undoable
4 features
| Feature | Type | Location | Size (bp) | Strand | |
|---|---|---|---|---|---|
| EGFP head | insert | 2–176 | 175 | + | |
| pUC19 MCS | vector | 176–2,839 | 2,664 | + | |
| M13F (-20) | primer_bind | 2,823–2,839 | 17 | + | |
| M13R (-27) | primer_bind | 223–239 | 17 | − |
07 / Translation & ORFs
Find the reading frame, then read it.
Six-frame ORF detection, whole-sequence translation, and protein-to-DNA reverse translation weighted by the organism you plan to express in.
- ORF finder across all six reading frames, circular-aware
- Whole-sequence and per-frame translation
- Six-frame translation strips on the linear map
- Reverse translation with best-codon or weighted sampling
- Codon optimisation for 10 organisms with CAI scoring
- E. coli, yeast, human, mouse, CHO, Pichia, B. subtilis, Arabidopsis, Drosophila, insect
- Protein property readout for any translated sequence
5 open reading frames
| Frame | Start | End | Length | Protein |
|---|---|---|---|---|
| −2 | 1,384 | 2,244 | 861 bp | 286 aa |
| +1 | 7 | 300 | 294 bp | 97 aa |
| +2 | 1,514 | 1,780 | 267 bp | 88 aa |
| +1 | 2,653 | 2,826 | 174 bp | 57 aa |
| +2 | 1,787 | 1,957 | 171 bp | 56 aa |
08 / Alignment, MSA & BLAST
Confirm the clone worked, or compare the whole family.
Align a Sanger read against your design, align up to 200 sequences at once, or send the construct to NCBI, without leaving the tab.
- Multiple sequence alignment of DNA, RNA or protein: up to 200 sequences of up to 30 kb each
- Built-in progressive aligner: k-mer distances, UPGMA guide tree, profile–profile alignment with affine gap penalties, BLOSUM62 for protein
- MAFFT, MUSCLE and Clustal Omega used automatically when installed on the server
- Consensus row, per-column conservation track, identity-matrix heat map and UPGMA tree
- Per-base colours for DNA, Clustal-X class colours for protein shaded by conservation; differences-only mode; click a column for detail
- Load sequences from open tabs, a saved construct, a FASTA paste or a file; export aligned FASTA, CLUSTAL or Newick
- Needleman–Wunsch global and Smith–Waterman local pairwise alignment
- BLOSUM62 for proteins, configurable match/mismatch and gap penalties for DNA
- NCBI BLAST: blastn, blastp, blastx, tblastn, tblastx
- Databases: nt, nr, refseq_rna, refseq_protein, swissprot, pdbnt, pdbaa
- Sanger read versus reference alignment with a mismatch table
Multiple sequence alignment
Identity matrix
| GFP_wildtype | – | 96 | 94 | 87 | 85 |
| EGFP_S65T | 96 | – | 92 | 83 | 81 |
| sfGFP | 94 | 92 | – | 83 | 80 |
| Clover | 87 | 83 | 83 | – | 76 |
| mNeonGreen | 85 | 81 | 80 | 76 | – |
Tree
Clustered from the matrix beside it, so the two can never disagree.
09 / Visualization
Circular, linear, and base by base.
The same sequence in three views that stay in sync: an annotated plasmid map, a linear map with translation strips, and the bases themselves with the complement strand.
- Circular plasmid map with annotations, labels and cut sites
- Linear map with feature arrows, primers and six-frame translations
- Base-level viewer with complement strand and position indices
- Zoom, pan and drag-selection across all three views
- Selection carries between views and into the toolbar
- Sanger chromatogram viewer with per-channel toggles and quality bars
- Export any map as SVG, PNG or PDF
- Properties tab: name, length, topology, GC, description and source format, the feature, enzyme, primer and ORF counts, and the GenBank header
See it in 1:07
pUC19 to pUC19-GFP: map, cutters, bases, insert, primers, export.
pUC19 MCS + EGFP head
2,839 bp, rendered by the same circular viewer the app uses, the light arc is the EGFP insert dropped into the MCS.
10 / Editing & history
Edit the construct, keep the annotations.
Cut, paste and reverse-complement operations shift and truncate the surrounding features rather than silently orphaning them, and every cloning run is recorded as a diagram of how the construct was built.
- Cut, copy, paste, paste reverse-complement and delete over a selection
- Annotations shift, truncate and reverse with the sequence
- Circular-aware operations across the origin
- Per-tab undo and redo with keyboard shortcuts
- Cloning history diagram: sources, reaction and product, drawn as real maps
- SnapGene history trees read out of .dna files and continued with your own operations
- Session history of everything loaded and cloned, with size, topology and origin
- Reopen any product from history as a new sequence
- Lineage tab for workspace constructs: the parent sequences with your selection mapped through the assembly, and which children used that region
5 events
- LOADEDSNCA Genomic Sequence137,977 bp · DNA4 h ago
- LOADEDNM_078601.49,269 bp · DNA4 h ago
- LOADEDpUC19 Plasmid2,686 bp · DNA · circular · 12 features · example:pUC194 h ago
- CLONEDpUC19 MCS + EGFP head2,839 bp · Restriction03/09/2026
- CLONEDpUC19-GFP (Gibson)3,403 bp · Gibson assembly02/09/2026
11 / Files & workspaces
Open what your lab already has.
Real parsers, including a binary SnapGene .dna reader, not a rename-and-hope importer. Sequences and workspaces persist per user.
- Import GenBank (.gb, .gbk, .genbank), EMBL and ApE (.ape)
- Import FASTA (.fasta, .fa)
- Import SnapGene .dna, including features and primers
- Import SnapGene .gel documents and Staden .scf
- Import Sanger traces: AB1, SCF and ZTR
- Import annotation tracks: BED, GFF3, GTF
- Import and export the OpenCloning cloning-strategy JSON, as .json or as a .zip that carries the sequencing traces
- Export GenBank and FASTA; export maps as SVG, PNG, PDF or DOCX
- Export primers as CSV or FASTA, and alignments as FASTA, CLUSTAL or Newick
- Print preview of a whole construct, downloadable as PDF or Word
- Workspaces and sequences saved per user, with multi-document tabs
Import and export
Import
Export
12 / Search
Find it in the sequence, or in the catalog.
Search runs across the sequence itself and across everything annotated on it, with hits highlighted in whichever view you are in.
- Sequence search with hits highlighted on the circular and linear maps
- Enzyme search by name or recognition site, with autocomplete over the catalog
- Feature search by name and type
- Primer search across detected priming sites
- Plasmid library browser and Addgene lookup
Search
Sequences
Features
Primers
13 / Beyond SnapGene
The parts a sequence editor was never going to do.
Structure prediction, docking and an assistant that can read your workspace: the reason this is one tab instead of four.
- FoldRx: fold → pockets → dock → ADMET → pose checks → selectivity → rank → design, as one pipeline
- ESMFold structure prediction with confidence scoring
- ADMET profiling: Lipinski, PAINS, hERG, Ames, Caco-2
- AI assistant that reads the active sequence and suggests strategies
- CRISPR gRNA finder with on-target scoring and in-sequence off-target checks
- Gene, variant and disease analysis; UCSC genome and GTEx expression
- Vendor hand-off: build an IDT or NEB order link from a selection
- Assistant conversations kept and resumable, routed across several models
- An MCP server, so the whole toolset is callable from your own agents
See it in 0:47
GFP folded, pLDDT colours, notebook, FoldRx.
Sequence to ranked candidates
| Stage | Runs | Produces |
|---|---|---|
| 01 Fold | ESMFold | 3D model, pLDDT per residue |
| 02 Pockets | P2Rank | Ranked binding pockets |
| 03 Dock | AutoDock Vina | Poses and binding energies |
| 04 ADMET | ADMET-AI · RDKit rules | Predicted liabilities |
| 05 Pose checks | PoseBusters · Boltz-2 affinity | Valid poses, rescored |
| 06 Selectivity | Anti-target panel | Off-target margins |
| 07 Rank | Weighted composite | Ordered candidates, CSV |
14 / Platform
Nothing to install.
SnapGene ships a desktop build per operating system. Talindrew runs in the browser, so the version you open is the current one and your sequences are already there.
- Runs in any modern browser: macOS, Windows, Linux
- No install, no licence server, no per-seat desktop build
- Opens 100 kb+ sequences, standing down only the automatic scans that would stall the view, and saying which
- An overview page with quick samples, a sample project and recent activity
- In-app documentation
- Work persists server-side across machines
- Optional Electron desktop shell
- Free to start, no credit card
138 kb sequence:
features, editing and navigation work normally. These automatic analyses are paused to keep the view responsive:
- · Automatic restriction-site scanning
- · Automatic variant/disease detection
- · Open reading frame track
Select a region and use the Tools menu to run any of them on that range.
15 / Lab notebook
The write-up lives next to the design, not in another tab.
A full electronic lab notebook with the cloning result, the plasmid map, the gel and the trace saved into the entry as live blocks. Resources and inventory, templates and protocols, review with e-signatures, and a two-way sync with eLabFTW for labs that already run one.
- Rich-text or markdown entries with tables, equations, code and images
- Save to notebook from every cloning wizard, the viewer, gels, traces and primer tables
- Typed fields, structured tables, custom ids, tags, categories and statuses
- Templates and protocols with checklists and deadlines
- Resources with types, storage locations, containers, compounds with PubChem lookup, QR labels
- Equipment booking with overlap and cancellation rules, iCal export
- Submit, review, witness and approve with re-authenticated signatures and timestamps
- Versions with restore, comments, changelog and audit log
- PubMed and Europe PMC search, cited straight into an entry
- A sample project waiting on your first visit
- Search grammar: title:, tag:, status:, date:>=, author:me
- Export to PDF, ZIP, JSON, CSV and the .eln archive; share a read-only link or print
- eLabFTW sync: browse, import, push, reconcile conflicts, sync all
- A cloning workspace reaction saved into an entry as a cloning block, with its inputs, primers, product map and traces, linking back to the workspace
See it in 0:55
Live cloning, gel and structure blocks, review, signature, export.
pUC19 MCS + EGFP head, cloning
Start with a worked example
Every cloning wizard has a Load demo button. You don't need a sequence of your own to see the whole loop.
Or watch one built end to end: Plan a whole cloning strategy on one canvas (5 min).