Reverse complement calculator

The reverse complement of a DNA sequence is the opposite strand read 5′→3′: complement every base (A↔T, G↔C), then reverse the order. It is the sequence a reverse primer must match and what the antisense strand reads. IUPAC ambiguity codes complement in pairs (R↔Y, K↔M; S, W and N map to themselves).

Result

Reverse complement (5′ → 3′)
AAGTTCTTCTCCTTTGCTAGCCAT
Complement (3′ → 5′)
TACCGATCGTTTCCTCTTCTTGAA
Reverse (3′ → 5′)
TTCAAGAAGAGGAAACGATCGGTA

The reverse complement is the sequence of the opposite strand read 5′→3′ — what you order as the reverse primer's template match. IUPAC codes complement per Cornish-Bowden 1985.

Doing this for a real construct?

Talindrew runs it on your actual sequence — editor, cloning wizards and analysis in the browser, free.

Sign up free

Formula

revcomp(s) = reverse(complement(s)), A↔T · G↔C · R↔Y · K↔M · B↔V · D↔H · S,W,N ↔ themselves

Source: IUPAC nucleotide code (Cornish-Bowden, NAR 1985)

Worked example

Given: 5′-ATGGCTAGC-3′

  1. 1.Complement each base: TACCGATCG (read 3′→5′).
  2. 2.Reverse the order: GCTAGCCAT.

Reverse complement = 5′-GCTAGCCAT-3′

How the calculation flows

Reverse complement calculator — calculation flowTwo operations compose the reverse complement: base-wise complementation, then reversal to restore 5′→3′ orientation.sequence5′ → 3′complementA↔T, G↔Creverseflip orderrevcomp5′ → 3′
Two operations compose the reverse complement: base-wise complementation, then reversal to restore 5′→3′ orientation.

Units & constants

AlphabetA C G T (U → T) plus all IUPAC ambiguity codes
OutputsReverse complement, complement (3′→5′), reverse
Input cleanupWhitespace, line numbers and FASTA breaks stripped automatically
Typical usesReverse-primer design, antisense probes, reading the minus strand
PriceFree

Which output do you actually want?

Almost always the reverse complement. The plain complement (3′→5′) is chemically the other strand but written backwards from how oligos are ordered; the plain reverse is rarely meaningful biologically. If you are ordering a reverse primer against a displayed top strand, take the reverse complement of the region the primer should cover — that is the sequence you paste into the order form, 5′→3′.

How do ambiguity codes complement?

Each IUPAC code maps to the code for the complementary base set: R (A/G) ↔ Y (C/T), K (G/T) ↔ M (A/C), B (not-A) ↔ V (not-T), D (not-C) ↔ H (not-G). S (G/C), W (A/T) and N are their own complements because their base sets are self-complementary. Degenerate primer designs survive reverse-complementation unchanged in degeneracy.

Frequently asked questions

Is the reverse complement the same as the antisense strand?
Yes, for a coding (sense) sequence: the antisense strand is its reverse complement. mRNA-targeting probes and reverse primers are designed as reverse complements of the sense sequence.
Does it handle RNA?
U is accepted and treated as T on input. Output is written in DNA alphabet; for an RNA reverse complement, replace T with U in the result.

Related calculators & guides

Use this calculator inside the app.

Free to use. No download required. Sign in and you land right back on this calculator.

Start for free