Connect Talindrew to Devin Desktop
Talindrew's MCP server gives Devin Desktop a molecular biology toolkit: plasmid maps, restriction digests and gels, primer and CRISPR design, PubMed search, your saved sequences and lab notebook, and structure prediction. Cascade reads MCP servers from mcp_config.json.
Server URL
https://mcp.talindrew.com/mcpAuthentication: OAuth in your browser.
Set it up
- In Cascade, open … → MCPs → Open MCP config file.
- Add the JSON below and save; Cascade picks it up and asks you to sign in.
~/.config/devin/mcp_config.json
{
"mcpServers": {
"talindrew": { "serverUrl": "https://mcp.talindrew.com/mcp" }
}
}Or let Devin Desktop set it up
Paste this into Devin Desktop; it adds Talindrew for you and checks the connection.
Set up the Talindrew MCP server in this app.
- Server name: talindrew
- URL: https://mcp.talindrew.com/mcp
- Transport: Streamable HTTP (remote). Authentication: OAuth; do not add any API key or header.
Use this app's own command or MCP config file (merge into the existing config; never remove other servers).
Then tell me how to start the sign-in (it opens Talindrew in my browser; signing in with Google creates a free
account). After I've signed in, call Talindrew's primer_tm tool on CGTTGTAAAACGACGGCCAGTGAAT and show the result.First things to ask
Use Talindrew to find the restriction sites in pUC19 and show me the map.With Talindrew, design PCR primers for bases 100-600 of this sequence: <paste DNA>Ask Talindrew for the melting temperature of CGTTGTAAAACGACGGCCAGTGAAT.Search PubMed with Talindrew for recent Golden Gate assembly protocols.
Remove or sign in again
Delete the entry from mcp_config.json.
You can also disconnect any app from Talindrew itself under Settings → Connected apps.
Cognition's documentation: docs.devin.ai
Frequently asked questions
Yes. Talindrew is a remote MCP server at https://mcp.talindrew.com/mcp. Devin Desktop connects to it over Streamable HTTP and signs in with OAuth; OAuth in your browser.
Devin Desktop shows Talindrew's results as text and data rather than interactive panels. Every result includes a link that opens it in the Talindrew app with the map, gel or tool ready.
Yes, to start. Connecting is free, and the sequence analysis, primer, CRISPR, literature and lab-notebook tools include 25 calls a week on the free plan; Plus ($9 a month, 7-day free trial) makes them unlimited. Structure prediction and FoldRx drug-discovery runs use the monthly allowance of a Pro or Max plan, exactly as in the app.
Try: "Use Talindrew to find the restriction sites in pUC19 and show me the map." or "Ask Talindrew for the melting temperature of CGTTGTAAAACGACGGCCAGTGAAT." Talindrew has 90 tools covering sequence analysis, digests and gels, primers, CRISPR guides, protein properties, cloning reactions in a workspace, PubMed and Europe PMC, NCBI Gene, Addgene, your saved sequences and notebook, and structure prediction.
Other apps
Start free
Free includes 25 tool calls a week; Plus ($9/month) makes them unlimited. Pro and Max add structure prediction and FoldRx.